If you have been reading about metabolic modulator and want a single page that covers the useful parts, this is it: definitions, context, how it is studied, and the questions that come up repeatedly.
Updated 2026-07-15. Numbers and descriptions here follow the published literature rather than marketing material.
Research interest in SR9009 grew from studies showing improved running endurance in mice after short treatment periods. Those experiments linked the compound to increased mitochondrial content and fatty acid oxidation in muscle, but the findings come from animal models and specific dosing schedules. Independent replication has been limited, and the pathways connecting REV-ERB activation to exercise performance are still being mapped. Whether similar responses occur in humans is an open question.
SR9009 is often grouped with compounds studied for circadian and metabolic regulation rather than with classical anabolic steroids. Its interactions with nuclear receptors differ from those of androgen receptor ligands, and its proposed mechanisms involve transcriptional control rather than direct hormone signaling. Some sources classify it as a metabolic modulator because of observed effects on energy utilization. The distinction matters for regulation and for interpreting research results across different compound classes.
SR9009 is a synthetic small molecule developed as a REV-ERB agonist. It binds to REV-ERBα and REV-ERBβ, nuclear receptors that help regulate circadian rhythms and metabolic gene expression. In cell and animal studies, the compound alters lipid and glucose handling and influences skeletal muscle oxidative capacity. Its exact effects in humans remain largely uncharacterized because controlled clinical trials have not been reported. The molecule is frequently described in preclinical literature as a metabolic modulator.
Handling recommendations for SR9009 in a laboratory setting include storing the solid at low temperature, protected from light and moisture. The compound is often dissolved in dimethyl sulfoxide or ethanol for experiments. Solutions should be prepared with appropriate personal protective equipment and disposed of according to local rules. Stability data for long-term storage are limited, so stock solutions are typically kept cold and used within defined periods. Records of preparation date and concentration support reproducibility.
SR9009 is not approved as a medicine by major regulatory agencies. It is commonly sold as a research chemical, a category that may fall outside customary drug approval and quality rules. In sports, the World Anti-Doping Agency lists SR9009 as a prohibited substance. Athletes who use it can face sanctions if it is detected in a sample. Legal status varies by country, and importation may be restricted. Enforcement practices differ across borders.
| Property | Value | Notes |
|---|---|---|
| Molecular formula | C20H24ClN3O4S | Reported for the free base |
| Molecular weight | 437.9 g/mol | Calculated from the formula |
| Primary target | REV-ERBα and REV-ERBβ | Nuclear receptors involved in circadian regulation |
| Solubility | Soluble in DMSO and ethanol | Poorly soluble in water |
| Typical storage | -20 °C, desiccated | Protect from light and moisture |
Because REV-ERB receptors are core clock components, SR9009 has been examined for effects on daily rhythms as well as metabolism. Research has explored whether the compound can shift or reinforce circadian gene expression in tissues such as liver and muscle. Some studies report improved metabolic markers in obese or diabetic mice, while others show context-dependent responses. Questions remain about which effects are direct, which are secondary to timing, and how they might differ across species.
SR9009 is a synthetic small molecule studied as an agonist of REV-ERB nuclear receptors. REV-ERB alpha and REV-ERB beta help regulate circadian rhythms and metabolic gene expression. In laboratory research, SR9009 has been used to probe how these receptors affect skeletal muscle, liver, and adipose tissue. The compound was identified in academic drug-discovery work and is often described in scientific literature by its chemical name and research code. It is not an approved medicine, and human clinical data remain limited or absent.
=== November === 1 November - Resident Craig Dentith’s fury over ‘appalling’ state of unfinished Winsford estate https://www.northwichguardian.co.uk/news/23892480.residents-fury-appalling-state-unfinished-development/
These CSPs are compatible with NP/RP and SFC and also used for analytical, semi-preparative and preparative separations. Many screening research studies conducted at different labs go to suggest that the four CSPs namely Chiralcel OD, Chiralcel OJ, Chiralpak AD, and Chiralpak As are capable of resolving more than 80% of the chiral separations due to their adaptability and high loading capacity. These four polysaccharide chiral stationary stationary phases are referred to as the "golden four". Polysaccharide CSPs are prepared with high quality silica support on to which the polymeric chiral selector (amylose/cellulose dr.) is physically coated (coated CSP) or chemically immobilized (immobilized CSP). Separations can be done in normal phase, reversed-phase, and polar organic mode. While working with coated polysaccharide CSP solvent selection should be done with caution. One should not use drastic solvents such as dichloromethane, chloroform, toluene, ethyl acetate, THF; 1,4-dioxane; acetone; DMSO, etc. These so called "non-standard" solvents will dissolve the silica and irreversibly destroy the stationary phase. The limited resistance of these coated phases to many solvents lead to the development of immobilized polysaccharide CSP. The table below presents some of the immobilized CSP commercially available and with the alternates wherever accessible.
In 1946, the Atomic Bomb Casualty Commission (ABCC) was established by the National Research Council of the National Academy of Sciences by order of U.S. President Harry S. Truman to study the long-term effects of radiation on survivors of the atomic bombings. In 1975, the ABCC was replaced by the Radiation Effects Research Foundation (RERF). Organizations such as the United Nations Scientific Committee on the Effects of Atomic Radiation (UNSCEAR), founded in 1955, and the National Academy of Sciences - Advisory Committee on the Biological Effects of Ionizing Radiation (BEIR Committee), founded in 1972, analyze the effects of radiation exposure on humans on the basis of atomic bomb victims who have been examined and, in some cases, medically monitored for decades. They determine the course of the mortality rate as a function of the age of the radiation victims in comparison with the spontaneous rate, and also the dose-dependency of the number of additional deaths. To date, 26 UNSCEAR reports have been published and are available online, most recently in 2017 on the effects of the Fukushima nuclear accident. By 1949, Americans felt increasingly threatened by the possibility of nuclear war with the Soviet Union and sought ways to survive a nuclear attack. The U.S. Federal Civil Defense Administration (USFCDA) was created by the government to educate the public on how to prepare for such an attack. In 1951, with the help of this agency, a children's educational film was produced in the U.S.
perlatum's physiological responses are significantly influenced by water availability. The ability to maintain higher photosynthetic performance and pigment content in humid conditions suggests that P. perlatum is better adapted to environments with higher moisture levels. This adaptability makes P. perlatum useful as a bioindicator for monitoring ecological responses to climate change and varying moisture conditions in Mediterranean ecosystems. Lichenicolous (lichen-dwelling) fungi that have been recorded parasitising Parmotrema perlatum include Abrothallus parmotrematis, Briancoppinsia cytospora, Lichenoconium erodens, and Spirographa lichenicola.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
Sources: en.wikipedia.org
=== April === 7 April – It was announced that the Leaving Certificate grinds school, the Institute of Education in Dublin with 7,000 pupils, founded by Ray Kearns in 1969, had been sold to a British educational company. 9 April – An emergency was declared and flights into Dublin Airport were suspended briefly when the nose landing gear of a Ryanair flight from Liverpool to Dublin experienced a problem during landing. Four other arriving flights were diverted to Shannon Airport. Visit by Joe Biden
Additionally, models accounting for the simultaneous effect of pH, micelle and organic concentration have been suggested. These models allow for further enhancement of the optimization of the separation of weak acids and bases. One research group, Rukhadze, et al. derived a first order linear relationship describing the influence of micelle and organic concentration, and pH on the selectivity and resolution of seven barbiturates. The researchers discovered that a second order mathematical equation would more precisely fit the data. The derivations and experimental details are beyond the scope of this discussion. The model was successful in predicting the experimental conditions necessary to achieve a separation for compounds which are traditionally difficult to resolve. Jandera, Fischer, and Effenberger approached the modeling problem in yet another way. The model used was based on lipophilicity and polarity indices of solutes. The lipophilicity index relates a given solute to a hypothetical number of carbon atoms in an alkyl chain. It is based and depends on a given calibration series determined experimentally. The lipophilicity index should be independent of the stationary phase and organic modifier concentration. The polarity index is a measure of the polarity of the solute-solvent interactions. It depends strongly on the organic solvent, and somewhat on the polar groups present in the stationary phase. 23 compounds were analyzed with varying mobile phases and compared to the lipophilicity and polarity indices.
HGPS is caused by mutations that weaken the structure of the cell nucleus, making normal cell division difficult. The histone mark H4K20me3 is involved and caused by de novo mutations that occur in a gene that encodes lamin A. Lamin A is made but is not processed properly. This poor processing creates an abnormal nuclear morphology and disorganized heterochromatin. Patients also do not have appropriate DNA repair, and they also have increased genomic instability. In normal conditions, the LMNA gene codes for a structural protein called prelamin A, which undergoes a series of processing steps before attaining its final form, called lamin A. Prelamin A contains a "CAAX" where C is a cysteine, A an aliphatic amino acid, and X any amino acid. This motif at the carboxyl-termini of proteins triggers three sequential enzymatic modifications. First, protein farnesyltransferase catalyzes the addition of a farnesyl moiety to the cysteine. Second, an endoprotease that recognizes the farnesylated protein catalyzes the peptide bond's cleavage between the cysteine and -aaX. In the third step, isoprenylcysteine carboxyl methyltransferase catalyzes methylation of the carboxyl-terminal farnesyl cysteine. The farnesylated and methylated protein is transported through a nuclear pore to the interior of the nucleus. Once in the nucleus, the protein is cleaved by a protease called zinc metallopeptidase STE24 (ZMPSTE24), which removes the last 15 amino acids, which includes the farnesylated cysteine. After cleavage by the protease, prelamin A is referred to as lamin A.
3,4-Dimethoxyamphetamine (3,4-DMA), or simply dimethoxyamphetamine (DMA), is a psychedelic drug of the phenethylamine and amphetamine families. It is one of the dimethoxyamphetamine (DMA) series of positional isomers. The drug is also an analogue of other psychedelics like 3,4-methylenedioxyamphetamine (MDA), 3,4,5-trimethoxyamphetamine (TMA), and mescaline (3,4,5-trimethoxyphenethylamine). It has been reported to produce psychedelic effects in humans but only entactogen-like effects without stimulant- or psychedelic-like effects in animals.
== Euthanasia protocol == Lethal injection has also been used in cases of euthanasia to facilitate voluntary death in patients with terminal or chronically painful conditions. Euthanasia can be accomplished either through oral, intravenous, or intramuscular administration of drugs. In individuals who are incapable of swallowing lethal doses of medication, an intravenous route is preferred because it is the most reliable and rapid way to accomplish euthanasia. The following is a Dutch protocol for parenteral (intravenous) administration to obtain euthanasia, with the old protocol listed first and the new protocol listed second:
Sources: en.wikipedia.org
It is a synthetic REV-ERB agonist used mainly in preclinical research. It is not an approved medicine for human use.
It binds to REV-ERBα and REV-ERBβ, nuclear receptors involved in circadian and metabolic gene regulation. This can alter transcription of genes related to lipid and glucose metabolism in experimental models.
No controlled human trials have established that effect. Endurance findings come primarily from rodent studies, and human responses remain unknown.
Its legal status depends on the country and intended use. It is not an approved medicine in major jurisdictions. In sport, it is prohibited by anti-doping rules.